The role of the TRPV6 channel in cancer

Abstract

Abstract The TRPV6 channel belongs to the superfamily of transient receptor potential (TRP) channels, subfamily vanilloid, member 6. Its expression in health is mainly confined to epithelial tissue of different organs such as digestive tract, kidney, testis, ovaries and skin. Due to its high calcium selectivity over other TRP channels, this channel was shown to participate in close regulation of calcium homeostasis in the body. In cancer a number of pieces of evidence demonstrate its upregulation and correlation with the advanced stages in prostate, colon, breast, thyroid, and ovarian carcinomas. Little is known about its role in initiation or progression for most of cancers, though in prostate cancer its oncogenic potential in vitro has been suggested. The most probable mechanisms involve calcium signalling in the control of processes such as proliferation and apoptosis resistance, though in some cases first evidence was reported as to its likely protective role in some cancers such as colon cancer. Further studies are needed to confirm whether this channel does really have an oncogenic potential or is just the last hope for transformed cells/tissues to stop cancer.

[ V’yacheslav Lehen’kyi (left) graduated from the Department of Biochemistry, University of Taras Shevchenko, Kyiv, Ukraine. In 2001 he obtained his PhD in the physiology of vascular smooth muscles at the Institute of Pharmacology and Toxicology in Kyiv, Ukraine, before doing his first postdoc in cardiology in the University of Paris XI. For the second postdoc he moved to the Laboratory of Cell Physiology, Lille, France where he is currently doing his research as a Professor Assistant qualified as biochemist, molecular biologist together with his PhD student Maylis Raphaël (right). Prof. Natalia Prevarskaya (centre) is a full professor of physiology at the University of Lille, North of France, and a Head of the Laboratory of Cell Physiology, INSERM U1003, certified by the INSERM (National Institute for Health and Medical Research), the part of Laboratory of Excellence, Ion Channels Science and Therapeutics, the head of the team “Calcium signatures of prostate cancer” certified by the National League Against Cancer. The field of expertise includes the function and regulation of ion channels, the role of ion channels and calcium signaling in carcinogenesis, calcium signaling in proliferation, apoptosis, migration and differentiation, in prostate cancer.]

Introduction

Transient receptor potential (TRP) channels constitute a large and functionally versatile superfamily of cation channel proteins that are expressed in many cell types from yeast to mammals (for reviews see Clapham, 2003; Vriens et al. 2004). The TRP superfamily contains a growing number of proteins in vertebrates and invertebrates unified by their homology to the product of the Drosophila trp gene, which is involved in light perception in the fly eye (Montell & Rubin, 1989). On the basis of structural homology, the superfamily can be subdivided into seven main subfamilies: TRPC (canonical), TRPV (vanilloid), TRPM (melastatin), TRPP (polycystin), TRPML (mucolipin), TRPA (ankyrin) and TRPN (no mechanoreceptor potential C, NOMPC) (for review see Vennekens et al. 2002; Clapham, 2003; Montell, 2005). Among them, in vertebrates, six TRPV channels have been identified. TRPV1 mediates nociception and contributes to the detection and integration of diverse chemical and thermal stimuli (Caterina et al. 2000; Jordt & Julius, 2002), TRPV2 and TRPV3 open upon heating, activating in the warm and noxious heat range (Kanzaki et al. 1999; Smith et al. 2002), TRPV4 plays a role in osmosensing, nociception and warm sensing (Liedtke et al. 2000; Nilius et al. 2004), and finally TRPV5 and TRPV6 are highly Ca²⁺-selective channels that play a role in Ca²⁺ reabsorption in the kidney and intestine (den Dekker et al. 2003; Hoenderop et al. 2003). It is really notable that among all TRP channels TRPV5 and TRPV6 are highly Ca²⁺ selective, with P_Ca/P_Na values exceeding 100; such high Ca²⁺ selectivity is unique within the TRP superfamily and makes these channels quite distinguishable, especially in Ca²⁺-related intracellular pathways.

TRPV6 channel in health

TRPV6 channel cDNA was cloned in 1999 from rat duodenum by expression cloning using Xenopus oocytes (Peng et al. 1999). The tissue distribution of TRPV6 has been studied extensively by Northern blot, RT-PCR analysis and immunohistochemistry, and in humans this channel is predominantly expressed in epithelia and the organs that mediate transcellular Ca²⁺ transport such as duodenum, jejunum, colon and kidney, and also in exocrine tissues such as pancreas, mammary gland, sweat gland and salivary gland (Peng et al. 2000; Hoenderop et al. 2001; Zhuang et al. 2002) (Fig. 1). TRPV6 is also expressed and plays an important role in the epidermis where the role of calcium is pivotal for skin differentiation (Lehen’kyi et al. 2007a). TRPV6-mediated Ca²⁺ transport is not coupled to Na⁺, Cl⁻, or H⁺, which is consistent with the prediction of early studies that Ca²⁺ uptake is not energy dependent. On the basis of electrophysiological analysis, the characteristics of TRPV6 were determined as it is strongly Ca²⁺ selective compared with other cations (Ca²⁺ >>> Ba²⁺, Sr²⁺) and its apparent affinity for Ca²⁺ (K_m) is 0.44 mm (Peng et al. 1999; Yue et al. 2001). This evidence strongly suggests that TRPV6 is a molecular candidate for the apical Ca²⁺ entry pathway. Considering the transcriptional regulation of TRPV6, it has been revealed that the mRNA expression increased owing to a low-Ca²⁺ diet (30-fold) or 1,25-vitamin D injection (21.5-fold) (Song et al. 2003). Moreover, recent studies conducted with TRPV6 knockout (KO) mice demonstrated that TRPV6 serves as a principle mechanism for apical intestinal Ca²⁺ absorption (Bianco et al. 2007). The TRPV6 KO mice exhibit disordered Ca²⁺ homeostasis, including defective intestinal Ca²⁺ absorption, increased urinary Ca²⁺ excretion, deficient weight gain and reduced fertility, suggesting the pivotal role in calcium homeostasis in tissues where this channel is expressed. The other group has shown that despite TRPV6 and other proteins involved in transcellular Ca²⁺ transport being dynamically expressed in bone cells, TRPV6 appears not to be crucial for bone metabolism and matrix mineralization in mice (van der Eerden et al. 2011). TRPV6 is also expressed in epididymal epithelium where the protein was detected in the apical membrane (Weissgerber et al. 2011). The replacement of a negatively charged aspartate in the pore-forming region with an uncharged alanine (D541A) renders heterologously expressed TRPV6 channels non-functional. The authors also found that male, but not female, mice homozygous for this mutation (Trpv6(D541A/D541A)) showed severely impaired fertility. The other interesting data concern one of the trpv6 allele containing three derived non-synonymous SNPs (157C, 378M, 681M) the frequency of which has been increased by positive selection in non-African populations (Sudo et al. 2010). Both electrophysiological and Ca²⁺-imaging analyses suggested that populations having these SNPs in TRPV6 in non-African areas may absorb higher Ca²⁺ from the intestine than ancestral-TRPV6 in the African area. Whether this polymorphism has any role in diseases or cancer is not known yet.

Figure 1

The expression of TRPV6 channel in health (left image, green) and its upregulation in cancer (right image, red)

Table 1. TRPV6 expression in non-pathological and pathological tissues and cell lines

Tissues	Non-pathological	Pathological (carcinoma)	Tissues	Non-pathological	Pathological (carcinoma)
Leukocytes	–^1, 4		Trachea	+^1
Fetal brain	+/–^1		Thyroid	+^5	+++^5
Whole brain	–^4+^1++^2		Parathyroid Gland	–^4
Cerebral cortex	+^1		Thymus	–^1, 4
Caudate nucleus	+^1		Fetal heart	++^1
Occipital lobe	+^1		Heart	–^2, 4
Putamen	+^1		Liver	–^2
Substantia nigra	+^1		Spleen	–^1,2, 4
Temporal lobe	+^1		Pancreas	+^4, 5+++^1, 2
Hippocampus	+^1		Lung	–^2, 4
Pituitary gland	+^1		Fetal kidney	++^1
Spinal cord	+^1		Kidney	–^4+^1++^2, 3	+^12
Salivary glands	+^4+++^1		Mammary gland	+^1, 5	+++^5
Oesophagus	–^2+^1, 5		Ovary	–^4+^5	++^5
Stomach	–^2, 4+^1, 5		Placenta	++^2+++^1, 4
Duodenum	+++^1, 2		Endometrium	–^4
Small intestine	–^4+^5		Testis	+^4++^2
Jejunum	+^1+++^1, 5		Prostate	Healthy –^4, 6+^1, 2, 3, 5	Low grade (GS<7) –^4, 6+^3
Ileus	–^1, 2
Large intestine	+/–^1+^5	+++^5			High grade (GS≥7) ++^3, 4, 5, 6
Colon–rectum	–^4+^5++^2	+++^5		BPH –^4, 6+^3
Bones	++^9				Lymph node metastasis +++^4
Skeletal muscle	–^1, 2, 4, 5
Epidermis	++^10
Sweat gland	+++^5
Cell lines	Non-pathological	Pathological (carcinoma)	Cell lines	Non-pathological	Pathological (carcinoma)
HeLa S3		–^1	HaCaT	u+^7,10 d+++^7, 10
HL60		–^1	hPK	u+^7,10 d+++^7, 10
K-562		+^1	A549		–^1
MOLT-4		–^1	HEK293	–^3, 7
Raji		–^1	MCF-7		+++^11
SW480		+++^1	hBCE		+++^11
Caco-2		++^8	PrEC	+^3
Human Osteoblast	++^9		hPS	–^3
Human Osteoclast	++^9		BPH1	+^3
G361		–^1	LNCaP		+++^3
16HBE14o	++^8		PC3		++^3
			DU-145		++^3

• –, negative; –/+, faint; +, weak; ++, moderate; +++, strong. BPH, benign prostatic hyperplasia; GS, Gleason score; HL60, promyelocytic leukaemia HL-60; K-562, chronic myelogenous leukaemia K-562; MOLT-4, lymphoblastic leukaemia MOLT-4; Raji, Burkitt's lymphoma Raji; SW480, colorectal adenocarcinoma SW480; A549, lung carcinoma A549; G361, melanoma G361; Human bronchial epithelial, 16HBE14o; Caco-2, heterogeneous human epithelial colorectal adenocarcinoma cells; HaCaT, human keratinocytes cell line, undifferentiated (u) or differentiated (d); hPK, human primary keratinocytes, undifferentiated (u) or differentiated (d); HEK293, human embryonnic kidney; hBCE, human breast cancer epithelial primary culture; MCF-7, human breast cancer cell line; PrEC, healthy human prostate epithelial cells; hPS, human prostate stromal cells; BPH1, human benign prostatic hyperplasia immortalized cell lines; DU-145, androgen resistant prostate adenocarcinoma cell lines from brain metastasis; PC3 androgen resistant prostate adenocarcinoma cell lines from bone metastasis; LNCaP, androgen responsive prostate adenocarcinoma cell line from lymph node metastasis. ¹ Peng et al. (2000), ²Müller et al. (2000), ³ Peng et al. (2001), ⁴ Wissenbach et al. (2001), ⁵ Zhuang et al. (2002), ⁶ Fixemer et al. (2003), ⁷ Lehen’kyi et al. (2007), ⁸ Borthwick et al. (2008), ⁹ Van der Eerden et al. (2011), ¹⁰ Lehen’kyi et al. (2011), ¹¹ Dhennin-Duthille et al. (2011), ¹²Yongyang et al. (2011).

TRPV6 channel in cancer

When compared with normal tissue or cells, the expression of TRPV6 mRNA (measured using semi-quantitative or real time quantitative RT-PCR) and/or expression of the TRPV6 protein (measured by immunofluorescence) is substantially increased in prostate cancer tissue, and in human carcinomas of the colon, breast, thyroid and ovary (Peng et al. 2001; Wissenbach et al. 2001; Zhuang et al. 2002; Fixemer et al. 2003) (Fig. 1).

More extensive studies of TRPV6 expression have been made in prostate cancer. The expression of TRPV6 mRNA is very low or not detectable in healthy and benign human prostate tissue (Wissenbach et al. 2001; Fixemer et al. 2003). Studies with prostate cancer tissue obtained from biopsies or resections show substantial expression of TRPV6 mRNA which increases with the degree of aggressiveness of the cancer, assessed by the Gleeson score (grading of the pathological stage) and the degree of metastasis outside the prostate (Peng et al. 2001; Fixemer et al. 2003). These observations have led to the suggestion that the level of expression of TRPV6 could be used as a marker to predict the clinical outcome of prostate cancer (Fixemer et al. 2003; Bodding, 2007).

Increased expression of TRPV6 mRNA is also observed in human prostate cancer cell lines (LNCaP, PC-3) as compared to the normal and benign epithelial cells (PrEC, BPH1) (Peng et al. 2001). The hypothesis on the potential involvement of TRPV6 channel in prostate cancer carcinogenesis has been made. The first data showed that TRPV6 increases cell proliferation of HEK-293 cells in a Ca²⁺-dependent manner and the increased proliferation correlates with slightly increased intracellular Ca²⁺ levels without interfering with the intrinsic Ca²⁺ dependence of HEK-293 cell proliferation (Schwarz et al. 2006). Prevarskaya's team have subsequently shown that TRPV6 is directly involved in the control of proliferation in LNCaP cells since its specific siRNA decreases (i) proliferation rate, (ii) cell accumulation into S-phase of the cell cycle, and (iii) proliferating cell nuclear antigen (PCNA) expression (Lehen’kyi et al. 2007b). This team has demonstrated that Ca²⁺ uptake into LNCaP cells is mediated by TRPV6, with the subsequent downstream activation of nuclear factor of activated T cells (NFAT). The possible role of androgens in the regulation of TRPV6 mRNA expression remains unclear. Previous studies have shown that the androgen receptor agonist dihydrotestosterone inhibits TRPV6 expression while the androgen receptor antagonist bicalutamide increases TRPV6 expression (Peng et al. 2001; Vanden Abeele et al. 2003; Bodding et al. 2003). However, TRPV6 expression has not been identified in androgen-insensitive prostate cancer cell lines DU-145 and PC-3 (Fixemer et al. 2003) and, moreover, Lehenkyi et al. have shown that TRPV6 expression in LNCaP cells is regulated by androgen receptor, but in a ligand-independent fashion (Lehen’kyi et al. 2007b). To date, little is known about whether the observed increased expression of TRPV6 mRNA and protein in prostate cancer cells is associated with increased Ca²⁺ and Na⁺ entry through functional TRPV6 channels, and what the physiological and pathological consequences might be (Bodding, 2007). Thus, LNCaP cells might be a useful model to study TRPV6 in a more native environment than is the case in the various overexpression systems. So far, no electrophysiological data have yet become available from non-transfected cell lines and primary cell cultures. Therefore, it is also unknown whether TRPV6 channels are functional in malignant tissue. The independent study on the known two alleles of trpv6, a and b, in healthy control individuals and prostate cancer patients has revealed them as not significantly different, suggesting that in the case of prostate cancer the TRPV6 genotype does not correlate with the onset of the cancer, the Gleason score and the tumour stage (Kessler et al. 2009).

TRPV6 mRNA is also expressed in the colorectal cancer cell line SW480 and to a lesser extent in the chronic myelogenous leukaemia cell line K-562 (Peng et al. 2000). This is at least partially in agreement with the immunohistochemical experiments showing an elevated expression of TRPV6 in comparison with normal tissues in colon, breast, thyroid and ovarian carcinomas (Zhuang et al. 2002). However, no up-regulation of TRPV6 transcripts was observed in other malignancies such as pancreatic carcinoma, arguing against TRPV6 as a general marker for neoplasms (Wissenbach et al. 2001).

In this context, a novel mechanism has been recently shown by which the TRPV6 channel might exert antitumour effects via its up-regulation in colon cancer (Bartik et al. 2010). TRPV6 is a major calcium transporter in the small intestine (Zhuang et al. 2002; Song et al. 2003), where its role in vitamin D-stimulated calcium transport has been well demonstrated (Nijenhuis et al. 2003). Several studies have indicated that high dietary calcium protects against risk for colon cancer (Lipkin & Newmark, 1985; Slattery et al. 1988). Thus, a ligand of 1,25-vitamin D3 receptor that up-regulates TRPV6 in vivo, such as curcumin, may perhaps play a role similar to that of 1,25-vitamin D3 in promoting calcium uptake as part of the protective effect against colon cancer (Bartik et al. 2010). The other evidence has been brought by the studies showing that TRPV6, and not TRPV1 (the well-known capsaicin receptor), can mediate capsaicin-induced apoptosis in gastric cells (Chow et al. 2007). Therefore, the abundance of TRPV6 channel in gastric cells can determine their destiny under capsaicin treatment making the latter a promising dietary candidate for cancer chemoprevention.

Table 2. Methods for TRPV6 detection and sequences of probes, primers and antibody epitopes

Ref.	Authors	Methods used	Human TRPV6 Target	Technique details (probes, sequences of primers, antibody epitopes)
1	Peng et al. (2000)	Northern/dot blot	Human small intestine hCaT1 (GenBank No. AF304463)	^32P-Labelled hCaT1 cDNA
		Dot blot
2	Müller et al. (2000)	Qualitative PCR	Human Kidney Cortex hECaC1 (GenBank No. AJ271207)	Forward: 5′-GACCTCAGAGATCGACTCG-3′
				Reverse: 5′-TCTGTGAGGTCATAGAGAGTC-3′
3	Peng et al. (2001)	Slot blot	hCaT1 (GenBank No. AF304463)	(α-32P)dCTP-labelled hCaT1 probes
		In situ hybridization		Nucleotides 772–1323 from the start codon from full length hCaT1
				Sens: 5′-GGGATTTAGGTGACACTATAGAAGCACCTGATGGGATTTAG
				GTGACACTATAGAAGCACCTGATGCAGAAGCGGA-3′
				Antisense: 5′-CTGTAATACGACTCACTATAGGGCACCATGGT
				CACCAGCACC-3′
		Real-time PCR (2-ΔCt)		Forward: 5′-AGCCTACATGACCCCTAAGGACG-3′
				Reverse: 5′-GTAGAAGTGGCCTAGCTCCTCGG-3′
4	Wissenbach et al. (2001)	Northern blot	Human placenta CaT-La/b (GenBank No. AJ243500/ AJ243501)	probe was a 345-bp EcoRI/BamHI fragment spanning the protein coding region of amino acid residues528–643 of the CaT-L protein
5	Zhuang et al. (2002)	Immunohistochemistry	hCaT1	Anti-serum against the last 19 amino-acid residues of the carboxyl terminus of hCaT1. Rabbit polyclonal Anti-CaT1 (R65291) and Chicken polyclonal IgYAnti-CaT1 (CH2747).
6	Fixemer et al. (2003)	In situ hybridization	Human TRPV6	Sense and antisense oligodesoxynucleotides (biotinylated at the 3′ end) of the amino-acid residues L11ILCLWSK, Q637DLNRQRI and F651HTRGSED of the TRPV6 sequence.
		Autoradiogram hybridization		Oligonucleotides Antisens of human TRPV6 fragment (nucleotides 1584 to 1928)
7	Lehen’kyi et al. (2007)	Qualitative PCR	Human TRPV6 (NCBI No. NM_018646)	Forward: 5′-ATGGTGATGCGGCTCATCAGTG-3′
				Reverse: 5GTAGAAGTGGCCTAGCTCCTCG-3′
		Western blot immunofluorescence	Human TRPV6 (SwissProt Q9H1D0)	Rabbit polyclonal Anti-TRPV6 (ACC 036) against the last 19 amino-acid residues of the carboxyl terminus (NH2-NRGLEDGESWEYQI-COOH)
8	Borthwick et al. (2008)	Western blot immunoprecipitation	Human TRPV6	Goat polyclonal antibody human TRPV6 (sc-31445) raised against a peptide mapping near the N-terminus.
9	Van der Eerden et al. (2011)	Real time PCR (2-ΔCt)	Human TRPV6	Forward: 5GCTTTGCTTCAGCCTTCTATATCAT3
				Reverse: 5′-TGGTAAGGAACAGCTCGAAGGT-3′
		Northern blot		Probes 56-carboxyfluorescein and 36-carboxytetramethylrhodamine labelled 5′-AGGAGCTAGGCCACTTCTACGACTACCCCA-3′
		Immunofluorescence		Rabbit polyclonal Anti-mouseTRPV6 against the last 15 amino-acid residues of the carboxyl terminus (NH2-INRGLEDGEGWEYQI-COOH)
10	Lehen’kyi et al. (2011)	Real-time PCR (2-ΔCt)	Human TRPV6 (NCBI accession No. NM_018646)	Forward: 5′-GCCTTCTATATCATCTTCC-3′
				Reverse: 5′-GGTGATGCTGTACATGAAGG3
		Immunofluorescence immunohistochemistry Biotinylation/Western blot		Rabbit polyclonal Anti-TRPV6 (ACC 036) against the last 19 amino-acid residues of the carboxyl terminus (NH2-NRGLEDGESWEYQI-COOH)
		Immunohistochemistry Western blot
11	Dhennin-Duthille et al. (2011)	Real time PCR	Human TRPV6 (NCBI accession No. NM_018646)	Forward: 5′-ATGGTGATGCGGCTCATCAGTG-3′
				Reverse: 5′-GTAGAAGTGGCCTAGCTCCTCG-3′
		Western blot		Goat polyclonal antibody human TRPV6 (sc-31445)

• The articles numbers refer to the same articles cited in superscript for the Table 1.

From the other side, in humans, overexpression of TRPV6 was associated with early-stage colon cancer, and inhibition of TRPV6 expression by small interfering RNA inhibited proliferation and induced apoptosis in colon carcinoma cells (Peleg et al. 2010). TRPV6 small interfering RNA also diminished the transcriptional activity of the calcium-dependent nuclear factors in activated T cells. The authors showed that the aberrant overexpression of TRPV6 contributes to colonic crypt hyperplasia in mice and to colon cancer cell proliferation in humans. Therefore, they concluded it is likely that the suppression of TRPV6 by a high calcium diet is required for its protective effects in the colon (Peleg et al. 2010).

TRPV6 is strongly expressed in breast adenocarcinoma tissue (Bolanz et al. 2008). The in vitro model showed that TRPV6 can be regulated by oestrogen, progesterone, tamoxifen and 1,25-vitamin D3 and has a large influence on breast cancer cell proliferation (Bolanz et al. 2009). The effect of tamoxifen on cell viability was enhanced when TRPV6 expression was silenced with small interfering RNA. TRPV6 may be a novel target for the development of calcium channel inhibitors to treat breast adenocarcinoma expressing TRPV6. The recent work has shown that TRPV6 is mainly overexpressed in the invasive breast cancer cells and the selective silencing of TRPV6 inhibited MDA-MB-231 migration and invasion, as well as MCF-7 migration (Dhennin-Duthille et al. 2011).

TRPV6 was also shown to be expressed in rat basophilic leukaemia cells where it functions as a Ca²⁺-sensing Ca²⁺ channel independently of procedures known to deplete Ca²⁺ stores (Bodding et al. 2002). It has been demonstrated that TRPV5 and TRPV6 channel proteins are present in both the total lysates and the crude membrane preparations from leukaemia cells (Semenova et al. 2009). Immunoprecipitation revealed that a physical interaction between TRPV5 and TRPV6 may take place. In this work single-channel patch-clamp experiments demonstrated the presence of inwardly rectifying monovalent currents that displayed kinetic characteristics of unitary TRPV5 and/or TRPV6 currents and were blocked by extracellular Ca²⁺ and ruthenium red.

It should be noted that TRPV5, a channel very close to TRPV6 (75% of homology), was originally cloned from rabbit kidney, and belongs to the ‘apical calcium channels’ family like TRPV6 channel. Unlike the other four members of the TRPV family that are non-selective cation channels, TRPV5 together with TRPV6 is a remarkable Ca²⁺-selective channel that serves for apical calcium entry in absorptive and secretory tissues (Nijenhuis et al. 2003). However no data have been provided so far regarding the potential involvement of TRPV5 or TRPV6 channels in renal cancers, although the decreased TRPV5/TRPV6 expression was already reported in renal cell carcinoma, which correlated with the vitamin D receptor (Wu et al. 2011). On the other hand, endogenous TRPV5 mRNA expression was observed using RT-PCR analysis in human Jurkat T leukaemia cell line (Vasil’eva et al. 2008) and in K562 erythroleukaemia cell line (Semenova et al. 2009). K562 cells co-express TRPV5 and TRPV6 calcium channels that form a functional homotetrameric structure by interacting with each other. Based on the evidence that TRPV5/V6 expression levels are strongly controlled by 1,25-dihydroxyvitamin D3 that exerts antiproliferative effects and induces K562 cell differentiation, it has been suggested that TRPV5/TRPV6 channels regulate leukaemia cell differentiation in a 1,25-vitamin D3-dependent manner (Semenova et al. 2009).

In conclusion, TRPV6 expression correlates with tumour grades in many tissues, which inspires the idea of this channel as encoded by a possible oncogene. Yet, little is known about its exact role in initiation and/or progression for most of cancers, though the involvement of calcium signalling via the TRPV6 channel in the control of aberrant proliferation and apoptosis resistance has already been demonstrated. Besides, in some cases first evidence was reported as to its likely protective role in some cancers, such as colon cancer, which opens an avenue for further studies to confirm whether this channel does really have an oncogenic potential or is just the last hope for transformed cells/tissues to stop cancer.